Skip to main content
Addgene

pTarget: Ptaq-RFP_PlacIq-GFP
(Plasmid #192280)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192280 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAU66
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    RFP
  • Species
    Synthetic
  • Promoter Ptaq

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer AGAAAGCCATCCAGTTTACTTTGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP
  • Species
    Synthetic
  • Promoter PlacIq

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTarget: Ptaq-RFP_PlacIq-GFP was a gift from John van der Oost (Addgene plasmid # 192280 ; http://n2t.net/addgene:192280 ; RRID:Addgene_192280)
  • For your References section:

    The miniature CRISPR-Cas12m effector binds DNA to block transcription. Wu WY, Mohanraju P, Liao C, Adiego-Perez B, Creutzburg SCA, Makarova KS, Keessen K, Lindeboom TA, Khan TS, Prinsen S, Joosten R, Yan WX, Migur A, Laffeber C, Scott DA, Lebbink JHG, Koonin EV, Beisel CL, van der Oost J. Mol Cell. 2022 Dec 1;82(23):4487-4502.e7. doi: 10.1016/j.molcel.2022.11.003. Epub 2022 Nov 24. 10.1016/j.molcel.2022.11.003 PubMed 36427491