Skip to main content

pAGT8162 (AATG_dttLbCas12a-i_TTCG)
(Plasmid #192350)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192350 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAGM3946
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 2073
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AATG_dttLbCas12a-i_TTCG
  • Species
    A. thaliana (mustard weed), Synthetic; Lachnospiraceae bacterium ND2006
  • Insert Size (bp)
    4988
  • Mutation
    D156R; E925Q

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CCTGTCGGGTTTCGCCACCTC
  • 3′ sequencing primer GCCGTTACCACCGCTGCGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGT8162 (AATG_dttLbCas12a-i_TTCG) was a gift from Tom Schreiber (Addgene plasmid # 192350 ; http://n2t.net/addgene:192350 ; RRID:Addgene_192350)
  • For your References section:

    Enhancing gene editing and gene targeting efficiencies in Arabidopsis thaliana by using an intron-containing version of ttLbCas12a. Schindele P, Merker L, Schreiber T, Prange A, Tissier A, Puchta H. Plant Biotechnol J. 2023 Mar;21(3):457-459. doi: 10.1111/pbi.13964. Epub 2022 Nov 30. 10.1111/pbi.13964 PubMed 36382936