Skip to main content
Addgene

pSEVA351-Cpf1
(Plasmid #192361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192361 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSEVA351
  • Backbone manufacturer
    SEVA collection
  • Backbone size w/o insert (bp) 5120
  • Total vector size (bp) 9859
  • Modifications to backbone
    Insertion of a CRISPR-Cas12 cassette
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas12a, gRNA scaffold
  • Alt name
    Cpf1
  • Species
    Francisella novicida
  • Insert Size (bp)
    4757

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer gGATCCtcgatgtaacccactcgtgc
  • 3′ sequencing primer agttggtaccgtcgacctgca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ungerer, J., & Pakrasi, H. B. (2016). Cpf1 is a versatile tool for CRISPR genome editing across diverse species of cyanobacteria. Scientific reports, 6(1), 1-9.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CRISPR cassette form the vector pSL2680

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEVA351-Cpf1 was a gift from Juana María Navarro Llorens (Addgene plasmid # 192361 ; http://n2t.net/addgene:192361 ; RRID:Addgene_192361)
  • For your References section:

    SEVA-Cpf1, a CRISPR-Cas12a vector for genome editing in cyanobacteria. Baldanta S, Guevara G, Navarro-Llorens JM. Microb Cell Fact. 2022 May 28;21(1):103. doi: 10.1186/s12934-022-01830-4. 10.1186/s12934-022-01830-4 PubMed 35643551