pSEVA351-Cpf1
(Plasmid
#192361)
-
PurposeCRISPR-based vector for genome editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSEVA351
-
Backbone manufacturerSEVA collection
- Backbone size w/o insert (bp) 5120
- Total vector size (bp) 9859
-
Modifications to backboneInsertion of a CRISPR-Cas12 cassette
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas12a, gRNA scaffold
-
Alt nameCpf1
-
SpeciesFrancisella novicida
-
Insert Size (bp)4757
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer gGATCCtcgatgtaacccactcgtgc
- 3′ sequencing primer agttggtaccgtcgacctgca (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUngerer, J., & Pakrasi, H. B. (2016). Cpf1 is a versatile tool for CRISPR genome editing across diverse species of cyanobacteria. Scientific reports, 6(1), 1-9.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CRISPR cassette form the vector pSL2680
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEVA351-Cpf1 was a gift from Juana María Navarro Llorens (Addgene plasmid # 192361 ; http://n2t.net/addgene:192361 ; RRID:Addgene_192361) -
For your References section:
SEVA-Cpf1, a CRISPR-Cas12a vector for genome editing in cyanobacteria. Baldanta S, Guevara G, Navarro-Llorens JM. Microb Cell Fact. 2022 May 28;21(1):103. doi: 10.1186/s12934-022-01830-4. 10.1186/s12934-022-01830-4 PubMed 35643551