Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

betaTrCP mVenus reporter
(Plasmid #192458)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192458 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti
  • Backbone manufacturer
    n/a
  • Backbone size w/o insert (bp) 8765
  • Total vector size (bp) 9971
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CDC25B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1206
  • Mutation
    aa198-338
  • GenBank ID
    NM_021873.4
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • mVenus (C terminal on insert)
    • SV40 NLS (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttcaggtgtcgtgaggatcc
  • 3′ sequencing primer agagcggccgccctcgagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    betaTrCP mVenus reporter was a gift from Steven Cappell (Addgene plasmid # 192458 ; http://n2t.net/addgene:192458 ; RRID:Addgene_192458)
  • For your References section:

    Revealing beta-TrCP activity dynamics in live cells with a genetically encoded biosensor. Paul D, Kales SC, Cornwell JA, Afifi MM, Rai G, Zakharov A, Simeonov A, Cappell SD. Nat Commun. 2022 Oct 26;13(1):6364. doi: 10.1038/s41467-022-33762-3. 10.1038/s41467-022-33762-3 PubMed 36289220