pAc5-STABLE2-neo-RvCAHS3
(Plasmid
#192472)
-
PurposeStable expression of RvCAHS3 (fly codon optimized) in Drosophila cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAc5-STABLE2-neo
- Backbone size w/o insert (bp) 6882
- Total vector size (bp) 7581
-
Vector typeInsect Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCAHS3
-
Alt nameRvCAHS3
-
SpeciesRamazzottius varieornatus
-
Insert Size (bp)909
-
GenBank IDAB650501.1
- Promoter Ac5 promoter
-
Tag
/ Fusion Protein
- T2A-EGFP-T2A-neoR (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACACAAAGCCGCTCCATCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc5-STABLE2-neo-RvCAHS3 was a gift from Takekazu Kunieda (Addgene plasmid # 192472 ; http://n2t.net/addgene:192472 ; RRID:Addgene_192472) -
For your References section:
Stress-dependent cell stiffening by tardigrade tolerance proteins that reversibly form a filamentous network and gel. Tanaka A, Nakano T, Watanabe K, Masuda K, Honda G, Kamata S, Yasui R, Kozuka-Hata H, Watanabe C, Chinen T, Kitagawa D, Sawai S, Oyama M, Yanagisawa M, Kunieda T. PLoS Biol. 2022 Sep 6;20(9):e3001780. doi: 10.1371/journal.pbio.3001780. eCollection 2022 Sep. 10.1371/journal.pbio.3001780 PubMed 36067153