Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOPINF Ta-sro1 WWE-PARP
(Plasmid #192550)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192550 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pOPINF
  • Backbone manufacturer
    Berrow et al. (2007) PMID 17317681
  • Backbone size w/o insert (bp) 5142
  • Total vector size (bp) 6501
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
  • Alt name
    Ta-sro1
  • Alt name
    WWE-PARP fragment
  • Alt name
    Trp-Trp-Glu, poly(ADP-ribose) polymerase
  • Species
    Triticum aestivum
  • Insert Size (bp)
    1359
  • GenBank ID
    AEK94072
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His6, 3C protease cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CACCACCTTCTGATAGGCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    gene synthesis based on sequence information from Liu et al. 2004, PMID 24443520

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPINF Ta-sro1 WWE-PARP was a gift from Lennart Wirthmueller (Addgene plasmid # 192550 ; http://n2t.net/addgene:192550 ; RRID:Addgene_192550)
  • For your References section:

    The superior salinity tolerance of bread wheat cultivar Shanrong No. 3 is unlikely to be caused by elevated Ta-sro1 poly-(ADP-ribose) polymerase activity. Vogt S, Feijs K, Hosch S, De Masi R, Lintermann R, Loll B, Wirthmueller L. Plant Cell. 2022 Aug 18. pii: 6671231. doi: 10.1093/plcell/koac261. 10.1093/plcell/koac261 PubMed 35980152