Skip to main content

pCK364.306
(Plasmid #192642)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192642 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCK341 (Addgene #192640)
  • Backbone manufacturer
    Jesse Zalatan
  • Backbone size w/o insert (bp) 1726
  • Total vector size (bp) 8073
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    J306 scRNA
  • Alt name
    TTGTGTCCAGAACGCTCCGT
  • Species
    Synthetic
  • Insert Size (bp)
    731
  • Promoter BBa_J23119

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caagagattacgcgcagacc
  • 3′ sequencing primer ctggatttgttcagaacgctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCK364.306 was a gift from Jesse Zalatan (Addgene plasmid # 192642 ; http://n2t.net/addgene:192642 ; RRID:Addgene_192642)
  • For your References section:

    Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874