pCK411.RR1
(Plasmid
#192644)
-
PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJF121 (Addgene #113325)
-
Backbone manufacturerJesse Zalatan
- Backbone size w/o insert (bp) 2052
- Total vector size (bp) 2268
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBBa_J23119-RR1
-
gRNA/shRNA sequenceaactttcagtttagcggtct
-
SpeciesSynthetic
- Promoter BBa_J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTAGAAAAATAAACAAATAGGGGTTCCGCGC
- 3′ sequencing primer gggcggagcctatggaaaaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK411.RR1 was a gift from Jesse Zalatan (Addgene plasmid # 192644 ; http://n2t.net/addgene:192644 ; RRID:Addgene_192644) -
For your References section:
Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874