LentiU6-hASCL1 gRNA_1-MS2-Puro
(Plasmid
#192670)
-
PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcription
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman ASCL1 activating gRNA #1
-
gRNA/shRNA sequenceGCAGCCGCTCGCTGCAGCAG
-
SpeciesH. sapiens (human)
-
Entrez GeneASCL1 (a.k.a. ASH1, HASH1, MASH1, bHLHa46)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiU6-hASCL1 gRNA_1-MS2-Puro was a gift from Jeffrey Miner (Addgene plasmid # 192670 ; http://n2t.net/addgene:192670 ; RRID:Addgene_192670) -
For your References section:
Comparative analysis of dCas9-VP64 variants and multiplexed guide RNAs mediating CRISPR activation. Omachi K, Miner JH. PLoS One. 2022 Jun 28;17(6):e0270008. doi: 10.1371/journal.pone.0270008. eCollection 2022. 10.1371/journal.pone.0270008 PubMed 35763517