Skip to main content

LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
(Plasmid #192681)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192681 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mouse Hbb-bh1 activating gRNA #1
  • gRNA/shRNA sequence
    AGAGAGTCTGGGCAAGACAG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Hbb-bh1 (a.k.a. betaH, betaH1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro was a gift from Jeffrey Miner (Addgene plasmid # 192681 ; http://n2t.net/addgene:192681 ; RRID:Addgene_192681)
  • For your References section:

    Comparative analysis of dCas9-VP64 variants and multiplexed guide RNAs mediating CRISPR activation. Omachi K, Miner JH. PLoS One. 2022 Jun 28;17(6):e0270008. doi: 10.1371/journal.pone.0270008. eCollection 2022. 10.1371/journal.pone.0270008 PubMed 35763517