-
Purposegreen biosensor for cAMP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192782 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 6342
- Total vector size (bp) 7608
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG-Flamp2
-
SpeciesSynthetic
-
Insert Size (bp)1266
- Promoter CAG
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-G-Flamp2 was a gift from Jun Chu (Addgene plasmid # 192782 ; http://n2t.net/addgene:192782 ; RRID:Addgene_192782) -
For your References section:
An Improved Genetically Encoded Fluorescent cAMP Indicator for Sensitive cAMP Imaging and Fast Drug Screening. Liu W, Liu C, Ren PG, Chu J, Wang L. Front Pharmacol. 2022 May 12;13:902290. doi: 10.3389/fphar.2022.902290. eCollection 2022. 10.3389/fphar.2022.902290 PubMed 35694242