pet21a-aGFPnb-minimizer-cys-linker-YbbR-(PAS)5-H6
(Plasmid
#192789)
-
PurposeaGFP nanobody minimizer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labeling
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet21a (+)
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5443
- Total vector size (bp) 5873
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameantiGFP nanobody minimizer
-
SpeciesCamelus dromedarius
-
Insert Size (bp)528
-
Tags
/ Fusion Proteins
- ybbR (C terminal on insert)
- H6 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TTATGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference to anti-GFP nanobody minimizer:
Kirchhofer A, Helma J, Schmidthals K, Frauer C, Cui S, Karcher A, Pellis M, Muyldermans S, Casas-Delucchi CS, Cardoso MC, Leonhardt H, Hopfner KP, Rothbauer U. Modulation of protein properties in living cells using nanobodies. Nat Struct Mol Biol. 2010 Jan;17(1):133-8. doi: 10.1038/nsmb.1727. Epub 2009 Dec 13. PMID: 20010839.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pet21a-aGFPnb-minimizer-cys-linker-YbbR-(PAS)5-H6 was a gift from Jacob Piehler (Addgene plasmid # 192789 ; http://n2t.net/addgene:192789 ; RRID:Addgene_192789) -
For your References section:
Four-color single-molecule imaging with engineered tags resolves the molecular architecture of signaling complexes in the plasma membrane. Sotolongo Bellon J, Birkholz O, Richter CP, Eull F, Kenneweg H, Wilmes S, Rothbauer U, You C, Walter MR, Kurre R, Piehler J. Cell Rep Methods. 2022 Feb 4;2(2):100165. doi: 10.1016/j.crmeth.2022.100165. eCollection 2022 Feb 28. 10.1016/j.crmeth.2022.100165 PubMed 35474965