pBAD-HisD-CreiLOV
(Plasmid
#192817)
-
PurposeExpresses CreiLOV in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 3999
- Total vector size (bp) 4359
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsArabose are needed when expressed in bacteria
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCreiLOV
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)360
- Promoter araBAD promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GACGCTTTTTATCGCAACTCTCTAC
- 3′ sequencing primer TTTATCAGACCGCTTCTGCGTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-HisD-CreiLOV was a gift from Kiryl Piatkevich (Addgene plasmid # 192817 ; http://n2t.net/addgene:192817 ; RRID:Addgene_192817) -
For your References section:
Enhanced small green fluorescent proteins as a multisensing platform for biosensor development. Liang GT, Lai C, Yue Z, Zhang H, Li D, Chen Z, Lu X, Tao L, Subach FV, Piatkevich KD. Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022. 10.3389/fbioe.2022.1039317 PubMed 36324888