Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCRISPRv2-sgMaob-HepmCherry
(Plasmid #192829)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192829 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiCRISPRv2-Stuffer-HepmCherry
  • Backbone manufacturer
    Knouse Lab
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • gRNA/shRNA sequence
    ACGGATAAAGGATATACTTG
  • Species
    M. musculus (mouse)
  • Promoter U6 for sgRNA and hepatocyte-specific promoter (HS-CRM8-TTRmin module from Chuah et al. Molecular Therapy 2014) for mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-sgMaob-HepmCherry was a gift from Kristin Knouse (Addgene plasmid # 192829 ; http://n2t.net/addgene:192829 ; RRID:Addgene_192829)
  • For your References section:

    Genome-scale CRISPR screening in a single mouse liver. Keys HR, Knouse KA. Cell Genom. 2022 Dec 14;2(12):100217. doi: 10.1016/j.xgen.2022.100217. Epub 2022 Nov 15. 10.1016/j.xgen.2022.100217 PubMed 36643909