Skip to main content

pTXB1-pA-M.EcoGII
(Plasmid #192873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTXB1
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6745
  • Total vector size (bp) 8235
  • Modifications to backbone
    Ribosome binding site (RBS) was replaced by a canonical RBS sequence
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For pA-M.EcoGII protein expression, use T7 Express lysY competent E. coli cells (NEB C3010I). Protein expression protocol: BIND&MODIFY, a Long-range single-molecule mapping of chromatin modification in eukaryotes. doi: https://doi.org/10.1101/2021.07.08.451578
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pA-M.EcoGII
  • Insert Size (bp)
    1490
  • Promoter T7
  • Tag / Fusion Protein
    • 3X Flag Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTXB1-pA-M.EcoGII was a gift from Chong Tang (Addgene plasmid # 192873 ; http://n2t.net/addgene:192873 ; RRID:Addgene_192873)
  • For your References section:

    BIND&MODIFY: a long-range method for single-molecule mapping of chromatin modifications in eukaryotes. Weng Z, Ruan F, Chen W, Chen Z, Xie Y, Luo M, Xie Z, Zhang C, Wang J, Sun Y, Fang Y, Guo M, Tan C, Chen W, Tong Y, Li Y, Wang H, Tang C. Genome Biol. 2023 Mar 29;24(1):61. doi: 10.1186/s13059-023-02896-y. 10.1186/s13059-023-02896-y PubMed 36991510