pTXB1-pA-M.EcoGII
(Plasmid #192873)

• Purpose: pA-M.EcoGII expression plasmid, originally created for BIND&MODIFY method, a Long-range single-molecule mapping of chromatin modification in eukaryotes. doi: https://doi.org/10.1101/2021.07.08.451578
• Depositing Lab: Chong Tang
• Publication: Weng et al Genome Biol. 2023 Mar 29;24(1):61. doi: 10.1186/s13059-023-02896-y.

Backbone

• Vector backbone: pTXB1
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6745
• Total vector size (bp): 8235
• Modifications to backbone: Ribosome binding site (RBS) was replaced by a canonical RBS sequence
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For pA-M.EcoGII protein expression, use T7 Express lysY competent E. coli cells (NEB C3010I). Protein expression protocol: BIND&MODIFY, a Long-range single-molecule mapping of chromatin modification in eukaryotes. doi: https://doi.org/10.1101/2021.07.08.451578
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: pA-M.EcoGII
• Insert Size (bp): 1490
• Promoter: T7
• Tag / Fusion Protein:
  • 3X Flag Tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.07.08.451578v2.full.pdf for bioRxiv preprint.