Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMAT36
(Plasmid #192979)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192979 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRA301
  • Backbone size w/o insert (bp) 6611
  • Total vector size (bp) 7571
  • Modifications to backbone
    Bases 3897 to 818 amplified via PCR
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mirA-3xFLAG
  • Species
    A. tumefaciens
  • Insert Size (bp)
    321
  • GenBank ID
    NC_003062.2
  • Promoter T7
  • Tag / Fusion Protein
    • 3XFLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

MirA is a cytoplasmic protein from Agrobacterium tumefaciens and can be used in conjunction with pJLG038 or pJLG039, which carry an inducible T7 polymerase. It can be replaced with a gene of interest for high yield protein expression from a native host.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAT36 was a gift from Clay Fuqua (Addgene plasmid # 192979 ; http://n2t.net/addgene:192979 ; RRID:Addgene_192979)
  • For your References section:

    An Inducible T7 Polymerase System for High-Level Protein Expression in Diverse Gram-Negative Bacteria. Greenwich JL, Alakavuklar MA, Fuqua C. Microbiol Resour Announc. 2023 Feb 16;12(2):e0111922. doi: 10.1128/mra.01119-22. Epub 2023 Jan 16. 10.1128/mra.01119-22 PubMed 36645284
Commonly requested with: