Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJLG038
(Plasmid #192981)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192981 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSRKGm
  • Backbone size w/o insert (bp) 5739
  • Total vector size (bp) 8340
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    T7 polymerase
  • Species
    E. coli
  • Insert Size (bp)
    2652
  • GenBank ID
    NC_012971
  • Promoter lac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGAAAGCGGGCAGTGAGCGC
  • 3′ sequencing primer GTCAATTATTACCTCCACGGGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The T7 polymerase gene (1) was cloned from the chromosome of BL21(DE3).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJLG038 was a gift from Clay Fuqua (Addgene plasmid # 192981 ; http://n2t.net/addgene:192981 ; RRID:Addgene_192981)
  • For your References section:

    An Inducible T7 Polymerase System for High-Level Protein Expression in Diverse Gram-Negative Bacteria. Greenwich JL, Alakavuklar MA, Fuqua C. Microbiol Resour Announc. 2023 Feb 16;12(2):e0111922. doi: 10.1128/mra.01119-22. Epub 2023 Jan 16. 10.1128/mra.01119-22 PubMed 36645284
Commonly requested with: