pTol2CG NBT:NRGIIIa:polyA
(Plasmid
#193012)
-
PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa in neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDest Tol2CG2
-
Vector typeMammalian Expression ; transposon transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameNBT
-
Alt nameXenopus neural-specific beta tubulin regulatory sequence
-
SpeciesX. laevis (frog)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer CCTGGTGTCTGAAACACAGGC
- 3′ sequencing primer ggtctgcactcagctgagtgg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNRG1 type IIIa
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001322205.2
-
Entrez GeneNRG1 (a.k.a. ARIA, GGF, GGF2, HGL, HRG, HRG1, HRGA, MST131, MSTP131, NDF, NRG1-IT2, SMDF)
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer ccacaccatccactgattacacc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2CG NBT:NRGIIIa:polyA was a gift from William Talbot (Addgene plasmid # 193012 ; http://n2t.net/addgene:193012 ; RRID:Addgene_193012) -
For your References section:
Partial loss-of-function variant in neuregulin 1 identified in family with heritable peripheral neuropathy. Lysko DE, Meireles AM, Folland C, McNamara E, Laing NG, Lamont PJ, Ravenscroft G, Talbot WS. Hum Mutat. 2022 Sep;43(9):1216-1223. doi: 10.1002/humu.24393. Epub 2022 May 17. 10.1002/humu.24393 PubMed 35485770