pADC10-SETXhel
(Plasmid
#193056)
-
PurposeBaculovirus expression of human Senataxin helicase domain for protein production
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193056 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepADC10
- Backbone size w/o insert (bp) 5807
- Total vector size (bp) 8321
-
Vector typeMammalian Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSenataxin
-
Alt nameSETX, Sen1, ALS4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2514
-
Mutationcodon optimized for insect cell expression
-
GenBank ID23064 23064
-
Entrez GeneSETX (a.k.a. ALS4, AOA2, SCAN2, SCAR1, STEX, Sen1, bA479K20.2)
- Promoter hybrid p10 (insect) and CMV (human) expression
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGGAAACTTAAGCTTATGG
- 3′ sequencing primer ATCCTCTAGTACTTCTCGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADC10-SETXhel was a gift from Andrew Deans (Addgene plasmid # 193056 ; http://n2t.net/addgene:193056 ; RRID:Addgene_193056) -
For your References section:
Branchpoint translocation by fork remodelers as a general mechanism of R-loop removal. Hodson C, van Twest S, Dylewska M, O'Rourke JJ, Tan W, Murphy VJ, Walia M, Abbouche L, Nieminuszczy J, Dunn E, Bythell-Douglas R, Heierhorst J, Niedzwiedz W, Deans AJ. Cell Rep. 2022 Dec 6;41(10):111749. doi: 10.1016/j.celrep.2022.111749. 10.1016/j.celrep.2022.111749 PubMed 36476850