Skip to main content
Addgene

pADC10-SETXhel
(Plasmid #193056)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193056 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pADC10
  • Backbone size w/o insert (bp) 5807
  • Total vector size (bp) 8321
  • Vector type
    Mammalian Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Senataxin
  • Alt name
    SETX, Sen1, ALS4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2514
  • Mutation
    codon optimized for insect cell expression
  • GenBank ID
    23064 23064
  • Entrez Gene
    SETX (a.k.a. ALS4, AOA2, SCAN2, SCAR1, STEX, Sen1, bA479K20.2)
  • Promoter hybrid p10 (insect) and CMV (human) expression
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGGAAACTTAAGCTTATGG
  • 3′ sequencing primer ATCCTCTAGTACTTCTCGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pADC10-SETXhel was a gift from Andrew Deans (Addgene plasmid # 193056 ; http://n2t.net/addgene:193056 ; RRID:Addgene_193056)
  • For your References section:

    Branchpoint translocation by fork remodelers as a general mechanism of R-loop removal. Hodson C, van Twest S, Dylewska M, O'Rourke JJ, Tan W, Murphy VJ, Walia M, Abbouche L, Nieminuszczy J, Dunn E, Bythell-Douglas R, Heierhorst J, Niedzwiedz W, Deans AJ. Cell Rep. 2022 Dec 6;41(10):111749. doi: 10.1016/j.celrep.2022.111749. 10.1016/j.celrep.2022.111749 PubMed 36476850