Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHAGE-Gfi1b-mCh
(Plasmid #193065)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 193065 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE2-EF1a-MCS-IRES-Puro-W-loxP
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gfi1b-mCh
  • Species
    M. musculus (mouse)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-Gfi1b-mCh was a gift from Filipe Pereira (Addgene plasmid # 193065 ; http://n2t.net/addgene:193065 ; RRID:Addgene_193065)
  • For your References section:

    GATA2 mitotic bookmarking is required for definitive haematopoiesis. Silverio-Alves R, Kurochkin I, Rydstrom A, Vazquez Echegaray C, Haider J, Nicholls M, Rode C, Thelaus L, Lindgren AY, Ferreira AG, Brandao R, Larsson J, de Bruijn MFTR, Martin-Gonzalez J, Pereira CF. Nat Commun. 2023 Aug 14;14(1):4645. doi: 10.1038/s41467-023-40391-x. 10.1038/s41467-023-40391-x PubMed 37580379