Skip to main content

SFFV-mCh-GATA2
(Plasmid #193071)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193071 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    SFFV
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCh-GATA2
  • Species
    H. sapiens (human)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CTGCTTCCCGAGCTCTATAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SFFV-mCh-GATA2 was a gift from Filipe Pereira (Addgene plasmid # 193071 ; http://n2t.net/addgene:193071 ; RRID:Addgene_193071)
  • For your References section:

    GATA2 mitotic bookmarking is required for definitive haematopoiesis. Silverio-Alves R, Kurochkin I, Rydstrom A, Vazquez Echegaray C, Haider J, Nicholls M, Rode C, Thelaus L, Lindgren AY, Ferreira AG, Brandao R, Larsson J, de Bruijn MFTR, Martin-Gonzalez J, Pereira CF. Nat Commun. 2023 Aug 14;14(1):4645. doi: 10.1038/s41467-023-40391-x. 10.1038/s41467-023-40391-x PubMed 37580379