Lenti-sgCrebbp#2/Cre
(Plasmid
#193210)
-
PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL3.3
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgCrebbp#2
-
gRNA/shRNA sequenceAGCACTTACACCCGGAACTG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneCrebbp (a.k.a. CBP, CBP/p300, KAT3A, p300/CBP)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.28.485708v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-sgCrebbp#2/Cre was a gift from Julien Sage (Addgene plasmid # 193210 ; http://n2t.net/addgene:193210 ; RRID:Addgene_193210) -
For your References section:
A multiplexed in vivo approach to identify driver genes in small cell lung cancer. Lee MC, Cai H, Murray CW, Li C, Shue YT, Andrejka L, He AL, Holzem AME, Drainas AP, Ko JH, Coles GL, Kong C, Zhu S, Zhu C, Wang J, van de Rijn M, Petrov DA, Winslow MM, Sage J. Cell Rep. 2023 Jan 13;42(1):111990. doi: 10.1016/j.celrep.2023.111990. 10.1016/j.celrep.2023.111990 PubMed 36640300