Skip to main content
Addgene

Lenti-sgSpen#2/Cre
(Plasmid #193240)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193240 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.3
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgSpen#2
  • gRNA/shRNA sequence
    AAGTTCACGCCAGATCAGCG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Spen (a.k.a. Mint, mKIAA0929)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgSpen#2/Cre was a gift from Julien Sage (Addgene plasmid # 193240 ; http://n2t.net/addgene:193240 ; RRID:Addgene_193240)
  • For your References section:

    A multiplexed in vivo approach to identify driver genes in small cell lung cancer. Lee MC, Cai H, Murray CW, Li C, Shue YT, Andrejka L, He AL, Holzem AME, Drainas AP, Ko JH, Coles GL, Kong C, Zhu S, Zhu C, Wang J, van de Rijn M, Petrov DA, Winslow MM, Sage J. Cell Rep. 2023 Jan 13;42(1):111990. doi: 10.1016/j.celrep.2023.111990. 10.1016/j.celrep.2023.111990 PubMed 36640300