Skip to main content
Addgene

pX459_gRNA pAS single_hspCas9
(Plasmid #193311)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193311 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988)
  • Backbone manufacturer
    Feng Zhang laboratory
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
  • gRNA/shRNA sequence
    GTCACGACGTTGTAAAACGA
  • Species
    Synthetic
  • Mutation
    not applicable

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459_gRNA pAS single_hspCas9 was a gift from Simon Elsaesser (Addgene plasmid # 193311 ; http://n2t.net/addgene:193311 ; RRID:Addgene_193311)
  • For your References section:

    Generation of Amber Suppression Cell Lines Using CRISPR-Cas9. Meineke B, Elsasser SJ. Methods Mol Biol. 2023;2676:169-180. doi: 10.1007/978-1-0716-3251-2_12. 10.1007/978-1-0716-3251-2_12 PubMed 37277632