pCZGY2727
(Plasmid
#193330)
-
PurposeSite specific insertion using CRISPR/Cas9 editing of C. elegans ChrI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCFJ210
-
Backbone manufacturerErik Jorgensen Lab
- Backbone size w/o insert (bp) 7539
- Total vector size (bp) 12343
-
Modifications to backboneReplacement of Punc-119 driven unc-119 with hygromycin resistance driven by a ubiquitous promoter.
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHygromycin resistance
-
Insert Size (bp)4804
- Promoter Prps-0
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tgtcgaccgctagtgtagcttac
- 3′ sequencing primer AGCCAGTCTGCAGGTCGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY2727 was a gift from Yishi Jin (Addgene plasmid # 193330 ; http://n2t.net/addgene:193330 ; RRID:Addgene_193330) -
For your References section:
Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity. Blazie SM, Takayanagi-Kiya S, McCulloch KA, Jin Y. Elife. 2021 Jul 29;10. pii: 68336. doi: 10.7554/eLife.68336. 10.7554/eLife.68336 PubMed 34323215