Skip to main content

pCZGY2727
(Plasmid #193330)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193330 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFJ210
  • Backbone manufacturer
    Erik Jorgensen Lab
  • Backbone size w/o insert (bp) 7539
  • Total vector size (bp) 12343
  • Modifications to backbone
    Replacement of Punc-119 driven unc-119 with hygromycin resistance driven by a ubiquitous promoter.
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hygromycin resistance
  • Insert Size (bp)
    4804
  • Promoter Prps-0

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tgtcgaccgctagtgtagcttac
  • 3′ sequencing primer AGCCAGTCTGCAGGTCGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY2727 was a gift from Yishi Jin (Addgene plasmid # 193330 ; http://n2t.net/addgene:193330 ; RRID:Addgene_193330)
  • For your References section:

    Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity. Blazie SM, Takayanagi-Kiya S, McCulloch KA, Jin Y. Elife. 2021 Jul 29;10. pii: 68336. doi: 10.7554/eLife.68336. 10.7554/eLife.68336 PubMed 34323215