mGFP-hNET-R121A/K334A/R440A
(Plasmid
#193366)
-
Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6600
-
Modifications to backboneeGFP A206K mutation resulting in mGFP
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Norepinephrine Transporter
-
Alt nameNET, NAT, SLC6A2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1850
-
MutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA to GCA)
-
Entrez GeneSLC6A2 (a.k.a. NAT1, NET, NET1, SLC6A5)
- Promoter CMV
-
Tag
/ Fusion Protein
- monomeric GFP (mGFP) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer EGFP-C1 fw: GAAGCGCGATCACATGGTC
- 3′ sequencing primer EGFP-C1rv: AACCATTATAAGCTGCAATAAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mGFP-hNET-R121A/K334A/R440A was a gift from Harald Sitte (Addgene plasmid # 193366 ; http://n2t.net/addgene:193366 ; RRID:Addgene_193366) -
For your References section:
Phosphatidylinositol 4,5-bisphosphate (PIP2) facilitates norepinephrine transporter dimerization and modulates substrate efflux. Luethi D, Maier J, Rudin D, Szollosi D, Angenoorth TJF, Stankovic S, Schittmayer M, Burger I, Yang JW, Jaentsch K, Holy M, Das AK, Brameshuber M, Camacho-Hernandez GA, Casiraghi A, Newman AH, Kudlacek O, Birner-Gruenberger R, Stockner T, Schutz GJ, Sitte HH. Commun Biol. 2022 Nov 17;5(1):1259. doi: 10.1038/s42003-022-04210-1. 10.1038/s42003-022-04210-1 PubMed 36396757