Skip to main content

mGFP-hNET-R121A/K334A/R440A
(Plasmid #193366)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193366 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6600
  • Modifications to backbone
    eGFP A206K mutation resulting in mGFP
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Norepinephrine Transporter
  • Alt name
    NET, NAT, SLC6A2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1850
  • Mutation
    R121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA to GCA)
  • Entrez Gene
    SLC6A2 (a.k.a. NAT1, NET, NET1, SLC6A5)
  • Promoter CMV
  • Tag / Fusion Protein
    • monomeric GFP (mGFP) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer EGFP-C1 fw: GAAGCGCGATCACATGGTC
  • 3′ sequencing primer EGFP-C1rv: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mGFP-hNET-R121A/K334A/R440A was a gift from Harald Sitte (Addgene plasmid # 193366 ; http://n2t.net/addgene:193366 ; RRID:Addgene_193366)
  • For your References section:

    Phosphatidylinositol 4,5-bisphosphate (PIP2) facilitates norepinephrine transporter dimerization and modulates substrate efflux. Luethi D, Maier J, Rudin D, Szollosi D, Angenoorth TJF, Stankovic S, Schittmayer M, Burger I, Yang JW, Jaentsch K, Holy M, Das AK, Brameshuber M, Camacho-Hernandez GA, Casiraghi A, Newman AH, Kudlacek O, Birner-Gruenberger R, Stockner T, Schutz GJ, Sitte HH. Commun Biol. 2022 Nov 17;5(1):1259. doi: 10.1038/s42003-022-04210-1. 10.1038/s42003-022-04210-1 PubMed 36396757