vHB179
(Plasmid
#193458)
-
Purpose3xFLAG endogenous tagging of pandoravirus/mollivirus genes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonevHB66
-
Vector typePandoravirus/mollivirus Expression
-
Selectable markersnourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3xFLAG
-
SpeciesSynthetic
- Promoter ---
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTGTTGCGCGAATTCCATATGTCAGACTACAAAGACCATG
- 3′ sequencing primer aaaatAAGAACAAGATTACTTGTCATCGTCATCCTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vHB179 was a gift from Chantal Abergel (Addgene plasmid # 193458 ; http://n2t.net/addgene:193458 ; RRID:Addgene_193458) -
For your References section:
Evolution of giant pandoravirus revealed by CRISPR/Cas9. Bisio H, Legendre M, Giry C, Philippe N, Alempic JM, Jeudy S, Abergel C. Nat Commun. 2023 Jan 26;14(1):428. doi: 10.1038/s41467-023-36145-4. 10.1038/s41467-023-36145-4 PubMed 36702819