vHB8
(Plasmid
#193454)
-
PurposeExpression of GFP-Cas9-NLS and gRNA in A. castellanii
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonevc2
- Backbone size w/o insert (bp) 5699
- Total vector size (bp) 10526
-
Vector typeCRISPR
-
Selectable markersgeneticin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-Cas9-NLS
-
gRNA/shRNA sequenceNotI restriction site
-
SpeciesSynthetic; Acanthamoeba castellanii
- Promoter GAPDH
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCAATCCACCCATATGGTGAGCAAGGGCGAGGAGC
- 3′ sequencing primer GGTGGGGGCATCTAGATTAGTCACCGCCCAGCTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vHB8 was a gift from Chantal Abergel (Addgene plasmid # 193454 ; http://n2t.net/addgene:193454 ; RRID:Addgene_193454) -
For your References section:
Evolution of giant pandoravirus revealed by CRISPR/Cas9. Bisio H, Legendre M, Giry C, Philippe N, Alempic JM, Jeudy S, Abergel C. Nat Commun. 2023 Jan 26;14(1):428. doi: 10.1038/s41467-023-36145-4. 10.1038/s41467-023-36145-4 PubMed 36702819