vHB8
(Plasmid
#193454)
-
PurposeExpression of GFP-Cas9-NLS and gRNA in A. castellanii
-
Depositing Lab
-
Depositing OrganizationCNRS UMR 7256, Laboratoire Information Genomique et Structurale
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 193454-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 193454-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonevc2
- Backbone size w/o insert (bp) 5699
- Total vector size (bp) 10526
-
Vector typeCRISPR
-
Selectable markersgeneticin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-Cas9-NLS
-
gRNA/shRNA sequenceNotI restriction site
-
SpeciesSynthetic; Acanthamoeba castellanii
- Promoter GAPDH
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCAATCCACCCATATGGTGAGCAAGGGCGAGGAGC
- 3′ sequencing primer GGTGGGGGCATCTAGATTAGTCACCGCCCAGCTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 193454-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 193454-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vHB8 was a gift from Chantal Abergel (Addgene plasmid # 193454 ; http://n2t.net/addgene:193454 ; RRID:Addgene_193454) -
For your References section:
Evolution of giant pandoravirus revealed by CRISPR/Cas9. Bisio H, Legendre M, Giry C, Philippe N, Alempic JM, Jeudy S, Abergel C. Nat Commun. 2023 Jan 26;14(1):428. doi: 10.1038/s41467-023-36145-4. 10.1038/s41467-023-36145-4 PubMed 36702819