H1.M10.luc
(Plasmid
#193706)
-
PurposeExpressed a H1-core mutant by introducing multiple 7SK elements (PSE, spacer, and TATA box)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerpromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH1-core promoter with multiple 7SK domains (PSE, spacer, and TATA box) + N41
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are two nucleotide variations compared to the M11 sequence listed in the publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H1.M10.luc was a gift from Elena Herrera-Carrillo (Addgene plasmid # 193706 ; http://n2t.net/addgene:193706 ; RRID:Addgene_193706) -
For your References section:
Engineered mini H1 promoters with dedicated RNA Polymerase II or III activity. Gao Z, van der Velden YU, Fan M, van der Linden CA, Vink M, Herrera-Carrillo E, Berkhout B. J Biol Chem. 2020 Nov 5. pii: S0021-9258(20)00012-5. doi: 10.1074/jbc.RA120.015386. 10.1074/jbc.RA120.015386 PubMed 33154168