pTP-AAV-ChATen-mCherry
(Plasmid
#193741)
-
PurposeThis AAV vector contains a ChAT enhancer that drives mCherry expression in spinal cord skeletal motor neurons. Specificity of vector not characterized outside the mouse spinal cord.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193741 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV from Addgene Plasmid #37825
- Backbone size w/o insert (bp) 3777
- Total vector size (bp) 5683
-
Vector typeMammalian Expression, Mouse Targeting, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChAT enhancer, mini promoter, synthetic intron, mCherry
-
SpeciesM. musculus (mouse), Synthetic; Mouse
-
Insert Size (bp)1906
- Promoter 1000 bp ChAT enhancer with a 32 bp minimal promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgtagccatgctctaggaag
- 3′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
By replacing mCherry with gene of interest, this vector can be used for AAV-based delivery specifically into skeletal motor neurons in the spinal cord. The specificity of expression has not been characterized outside the spinal cord.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTP-AAV-ChATen-mCherry was a gift from Hynek Wichterle (Addgene plasmid # 193741 ; http://n2t.net/addgene:193741 ; RRID:Addgene_193741)