Skip to main content

pLenti-dCas9-T2A-GFP
(Plasmid #193781)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193781 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCas9-T2A-GFP
  • Backbone manufacturer
    Addgene #78548
  • Backbone size w/o insert (bp) 9581
  • Total vector size (bp) 13669
  • Modifications to backbone
    Replace Cas9 with dCas9
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dead Cas9
  • Alt name
    dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4233
  • Promoter In frame with existing Cas9 promoter
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaacgttctttttcgcaacgggtttgccgccagaacacaggaccggtgccgcccaccatg
  • 3′ sequencing primer gtcgcctcccagctgagacaggtcgatccgtgtctcgtacaggccggtgatgctctggtg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pZLCv2-3xFLAG-dCas9-HA-2xNLS (Addgene #106357)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.03.535384 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-dCas9-T2A-GFP was a gift from James Eshleman (Addgene plasmid # 193781 ; http://n2t.net/addgene:193781 ; RRID:Addgene_193781)
  • For your References section:

    CRISPR-Cas9 for selective targeting of somatic mutations in pancreatic cancers. Teh SSK, Bowland K, Halper-Stromberg E, Kotwal A, Bennett A, Skaist A, Tang J, Cai F, Macoretta A, Liang H, Kamiyama H, Wheelan S, Lin MT, Hruban RH, Hung CF, Goldstein M, Scharpf RB, Roberts NJ, Eshleman JR. NAR Cancer. 2024 Jun 19;6(2):zcae028. doi: 10.1093/narcan/zcae028. eCollection 2024 Jun. 10.1093/narcan/zcae028 PubMed 38915758