pLenti-dCas9-T2A-GFP
(Plasmid
#193781)
-
PurposeTricistronic expression of dCas9-EGFP-BSD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLentiCas9-T2A-GFP
-
Backbone manufacturerAddgene #78548
- Backbone size w/o insert (bp) 9581
- Total vector size (bp) 13669
-
Modifications to backboneReplace Cas9 with dCas9
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedead Cas9
-
Alt namedCas9
-
SpeciesSynthetic
-
Insert Size (bp)4233
- Promoter In frame with existing Cas9 promoter
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaacgttctttttcgcaacgggtttgccgccagaacacaggaccggtgccgcccaccatg
- 3′ sequencing primer gtcgcctcccagctgagacaggtcgatccgtgtctcgtacaggccggtgatgctctggtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypZLCv2-3xFLAG-dCas9-HA-2xNLS (Addgene #106357)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.03.535384 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-dCas9-T2A-GFP was a gift from James Eshleman (Addgene plasmid # 193781 ; http://n2t.net/addgene:193781 ; RRID:Addgene_193781) -
For your References section:
CRISPR-Cas9 for selective targeting of somatic mutations in pancreatic cancers. Teh SSK, Bowland K, Halper-Stromberg E, Kotwal A, Bennett A, Skaist A, Tang J, Cai F, Macoretta A, Liang H, Kamiyama H, Wheelan S, Lin MT, Hruban RH, Hung CF, Goldstein M, Scharpf RB, Roberts NJ, Eshleman JR. NAR Cancer. 2024 Jun 19;6(2):zcae028. doi: 10.1093/narcan/zcae028. eCollection 2024 Jun. 10.1093/narcan/zcae028 PubMed 38915758