pDSP16 (5’Δ Cbr-unc-119(+) + loxN + MCS + 5’Δ mNeonGreen)
(Plasmid
#193854)
-
PurposePromoterless insertion vector for split Cbr-unc-19(+)/mNeonGreen landing pad
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDSP1
- Total vector size (bp) 4703
-
Vector typeWorm Expression, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5' Cbr-unc-119(+) + 5' mNeonGreen
-
SpeciesSynthetic; C. briggsae
-
Insert Size (bp)2593
- Promoter Cbr-unc-119p
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagatgatgagccaagaagagtt
- 3′ sequencing primer GAAGTTCGTGAGTAGCTGGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCbr-unc-119(+) from pQL222 (Dr. QueeLim Ch’ng)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDSP16 (5’Δ Cbr-unc-119(+) + loxN + MCS + 5’Δ mNeonGreen) was a gift from Patrick Phillips (Addgene plasmid # 193854 ; http://n2t.net/addgene:193854 ; RRID:Addgene_193854) -
For your References section:
High-throughput library transgenesis in Caenorhabditis elegans via Transgenic Arrays Resulting in Diversity of Integrated Sequences (TARDIS). Stevenson ZC, Moerdyk-Schauwecker MJ, Banse SA, Patel DS, Lu H, Phillips PC. Elife. 2023 Jul 4;12:RP84831. doi: 10.7554/eLife.84831. 10.7554/eLife.84831 PubMed 37401921