1B-GFP1-10
(Plasmid
#193867)
-
PurposeE. coli expression vector for Hisx6 tagged GFP1-10.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbone1B
- Backbone size w/o insert (bp) 5328
- Total vector size (bp) 5997
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfGFP1-10
-
SpeciesSynthetic
-
Insert Size (bp)648
- Promoter T7 Promoter
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bysfGFP1-10 sequence cloned from PEP101E (Addgene: Plasmid #97387)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1B-GFP1-10 was a gift from Markita Landry (Addgene plasmid # 193867 ; http://n2t.net/addgene:193867 ; RRID:Addgene_193867) -
For your References section:
Delivered complementation in planta (DCIP) enables measurement of peptide-mediated protein delivery efficiency in plants. Wang JW, Squire HJ, Goh NS, Ni HM, Lien E, Wong C, Gonzalez-Grandio E, Landry MP. Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5. 10.1038/s42003-023-05191-5 PubMed 37573467