GreenT-EC - GPI
(Plasmid
#193946)
-
PurposeMammalian expression vector for a low affinity calcium indicator exposed to the cell surface
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA 3.1
- Backbone size w/o insert (bp) 5630
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreenT-EC
-
SpeciesBranchiostoma lanceolatum / Opsanus tau
-
Insert Size (bp)1212
-
Tags
/ Fusion Proteins
- Igk_secretion - HA-Flag (N terminal on insert)
- GPI-anchor (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAG
- 3′ sequencing primer GAGGCTGATCAGCGGGTTTAAACGGGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GreenT-EC - GPI was a gift from Oliver Griesbeck (Addgene plasmid # 193946 ; http://n2t.net/addgene:193946 ; RRID:Addgene_193946) -
For your References section:
Fluorescent sensors for imaging of interstitial calcium. Valiente-Gabioud AA, Garteizgogeascoa Suner I, Idziak A, Fabritius A, Basquin J, Angibaud J, Nagerl UV, Singh SP, Griesbeck O. Nat Commun. 2023 Oct 5;14(1):6220. doi: 10.1038/s41467-023-41928-w. 10.1038/s41467-023-41928-w PubMed 37798285