Lenti NbALFA-miRFP680 hygro
(Plasmid
#193969)
-
Purposelentivector coding for miRFP680 fused to a nanobody targeting the ALFA tag, hygromycin resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNbALFA-miRFP680
- Promoter EF1a
-
Tag
/ Fusion Protein
- miRFP680 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer gcctcagacagtggttcaaagtttt
- 3′ sequencing primer ctttataagggtcgatgtcggaac
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNbALFA sequence received from Steffen Frey
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti NbALFA-miRFP680 hygro was a gift from Raphael Gaudin (Addgene plasmid # 193969 ; http://n2t.net/addgene:193969 ; RRID:Addgene_193969)