p8266 LentiCRISPR v2 hygro sgNT-1
(Plasmid
#193977)
-
PurposeExpression of spCas9 and non-targeting control sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193977 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneplentiCRISPRv2 hygro
-
Backbone manufacturerBrett Stringer, Addgene #98291
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
-
gRNA/shRNA sequenceAGCTCGCCATGTCGGTTCTC
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p8266 LentiCRISPR v2 hygro sgNT-1 was a gift from Elizabeth White (Addgene plasmid # 193977 ; http://n2t.net/addgene:193977 ; RRID:Addgene_193977) -
For your References section:
Systematic Analysis of IL-1 Cytokine Signaling Suppression by HPV16 Oncoproteins. Castagnino P, Kim HW, Lam LKM, Basu D, White EA. J Virol. 2022 Nov 7:e0132622. doi: 10.1128/jvi.01326-22. 10.1128/jvi.01326-22 PubMed 36342298