Skip to main content

p8266 LentiCRISPR v2 hygro sgNT-1
(Plasmid #193977)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193977 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    plentiCRISPRv2 hygro
  • Backbone manufacturer
    Brett Stringer, Addgene #98291
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9
  • gRNA/shRNA sequence
    AGCTCGCCATGTCGGTTCTC
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p8266 LentiCRISPR v2 hygro sgNT-1 was a gift from Elizabeth White (Addgene plasmid # 193977 ; http://n2t.net/addgene:193977 ; RRID:Addgene_193977)
  • For your References section:

    Systematic Analysis of IL-1 Cytokine Signaling Suppression by HPV16 Oncoproteins. Castagnino P, Kim HW, Lam LKM, Basu D, White EA. J Virol. 2022 Nov 7:e0132622. doi: 10.1128/jvi.01326-22. 10.1128/jvi.01326-22 PubMed 36342298