pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP
(Plasmid
#194015)
-
PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerHetian Lei #85451
- Backbone size w/o insert (bp) 5163
- Total vector size (bp) 5183
-
Modifications to backboneaddition of gRNA
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesgRNA(Oxtr.1)
-
Alt namesgRNA(Oxtr)
-
gRNA/shRNA sequenceGGTGCTTCATGAAAAAGAAG
-
SpeciesM. musculus (mouse), R. norvegicus (rat); prairie vole, california deer mouse, golden hamster
-
Insert Size (bp)20
- Promoter u6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer cgcgtgagggcctatttcc
- 3′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Alt nameenhanced green fluorescent protein
-
gRNA/shRNA sequenceN/A
-
SpeciesAequorea victoria
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer Unknown
- 3′ sequencing primer Unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP was a gift from Larry Young (Addgene plasmid # 194015 ; http://n2t.net/addgene:194015 ; RRID:Addgene_194015) -
For your References section:
An AAV-CRISPR/Cas9 strategy for gene editing across divergent rodent species: Targeting neural oxytocin receptors as a proof of concept. Boender AJ, Boon M, Albers HE, Eck SR, Fricker BA, Kelly AM, LeDoux JE, Motta SC, Shrestha P, Taylor JH, Trainor BC, Triana-Del Rio R, Young LJ. Sci Adv. 2023 Jun 2;9(22):eadf4950. doi: 10.1126/sciadv.adf4950. Epub 2023 May 31. 10.1126/sciadv.adf4950 PubMed 37256960