Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE
(Plasmid #125713)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125713 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 125713-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$405
AAV5 125713-AAV5 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.
$405

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4645
  • Total vector size (bp) 6445
  • Modifications to backbone
    directional Cre-Lox sites
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eOPN3
  • Alt name
    Mosquito OPN3, optimized for mammalian neuron expression
  • Species
    Anopheles stephensi (Asian malaria mosquito)
  • Insert Size (bp)
    1821
  • Mutation
    deleted amino acids 331-429
  • GenBank ID
    AB753162.1
  • Promoter hSyn1
  • Tags / Fusion Proteins
    • mScarlet (C terminal on insert)
    • Rho1D4 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer hSyn1_fw (CAGCGCTGCCTCAGTCTGC)
  • 3′ sequencing primer WPRE_rev (CACATAGCGTAAAAGGAGCAAC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.02.18.431673v1 for the bioRxiv preprint.

Information for AAV1 (Catalog # 125713-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE (#125713). In addition to the viral particles, you will also receive purified pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE plasmid DNA.

Synapsin-driven, Cre-dependent expression of mosquito OPN3 rhodopsin in-frame with mScarlet.These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mScarlet (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV5 (Catalog # 125713-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE (#125713). In addition to the viral particles, you will also receive purified pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE plasmid DNA.

Synapsin-driven, Cre-dependent expression of mosquito OPN3 rhodopsin in-frame with mScarlet. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mScarlet (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 125713 ; http://n2t.net/addgene:125713 ; RRID:Addgene_125713)

    For viral preps, please replace (Addgene plasmid # 125713) in the above sentence with: (Addgene viral prep # 125713-AAV1) or (Addgene viral prep # 125713-AAV5)

  • For your References section:

    Efficient optogenetic silencing of neurotransmitter release with a mosquito rhodopsin. Mahn M, Saraf-Sinik I, Patil P, Pulin M, Bitton E, Karalis N, Bruentgens F, Palgi S, Gat A, Dine J, Wietek J, Davidi I, Levy R, Litvin A, Zhou F, Sauter K, Soba P, Schmitz D, Luthi A, Rost BR, Wiegert JS, Yizhar O. Neuron. 2021 May 10. pii: S0896-6273(21)00161-6. doi: 10.1016/j.neuron.2021.03.013. 10.1016/j.neuron.2021.03.013 PubMed 33979634