pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE
(Plasmid #125712)

• Purpose: Expresses an optimized mosquito OPN3 rhodopsin in-frame with mScarlet
• Depositing Lab: Ofer Yizhar
• Publication: Mahn et al Neuron. 2021 May 10. pii: S0896-6273(21)00161-6. doi: 10.1016/j.neuron.2021.03.013.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone size w/o insert (bp): 3788
• Total vector size (bp): 5609
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eOPN3
• Alt name: Mosquito OPN3, optimized for mammalian neuron expression
• gRNA/shRNA sequence: -
• Species: Anopheles stephensi (Asian malaria mosquito)
• Mutation: deleted amino acids 331-429
• GenBank ID: AB753162.1
• Promoter: short version of αCamKinase II promoter (0.4kb)
• Tags / Fusion Proteins:
  • mScarlet (C terminal on insert)
  • Rho1D4 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CKIIa_Fw (GATGCTGACGAAGGCTCGC)
• 3′ sequencing primer: WPRE_Rev (CACACAGCGTAAAAGGAGCAAC)

Resource Information

• Supplemental Documents:
  • D602_peAAV-CKIIa(0.4)-MosOPN3-ts-mScarlet-ER.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.02.18.431673v1 for the bioRxiv preprint.