Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE
(Plasmid #125712)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125712 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 3788
  • Total vector size (bp) 5609
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eOPN3
  • Alt name
    Mosquito OPN3, optimized for mammalian neuron expression
  • gRNA/shRNA sequence
    -
  • Species
    Anopheles stephensi (Asian malaria mosquito)
  • Mutation
    deleted amino acids 331-429
  • GenBank ID
    AB753162.1
  • Promoter short version of αCamKinase II promoter (0.4kb)
  • Tags / Fusion Proteins
    • mScarlet (C terminal on insert)
    • Rho1D4 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CKIIa_Fw (GATGCTGACGAAGGCTCGC)
  • 3′ sequencing primer WPRE_Rev (CACACAGCGTAAAAGGAGCAAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.02.18.431673v1 for the bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 125712 ; http://n2t.net/addgene:125712 ; RRID:Addgene_125712)
  • For your References section:

    Efficient optogenetic silencing of neurotransmitter release with a mosquito rhodopsin. Mahn M, Saraf-Sinik I, Patil P, Pulin M, Bitton E, Karalis N, Bruentgens F, Palgi S, Gat A, Dine J, Wietek J, Davidi I, Levy R, Litvin A, Zhou F, Sauter K, Soba P, Schmitz D, Luthi A, Rost BR, Wiegert JS, Yizhar O. Neuron. 2021 May 10. pii: S0896-6273(21)00161-6. doi: 10.1016/j.neuron.2021.03.013. 10.1016/j.neuron.2021.03.013 PubMed 33979634