pGWT35S-mCherry-NLS
(Plasmid
#194049)
-
PurposeTransient expression of mCherry-NLS in plant cell (Nucleus)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGWT35S
- Total vector size (bp) 4327
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)714
- Promoter CaMV 35S promoter
-
Tag
/ Fusion Protein
- SV40 (Nuclear localization signal) (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGAGCAAGGGCGAGGAGGA
- 3′ sequencing primer GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACACCTTGCGCTTCTTCTTAGGTCCCGACTTGTACAGCTCGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGWT35S-mCherry-NLS was a gift from Yutaka Kodama (Addgene plasmid # 194049 ; http://n2t.net/addgene:194049 ; RRID:Addgene_194049) -
For your References section:
Organellar Glue: A Molecular Tool to Artificially Control Chloroplast-Chloroplast Interactions. Ichikawa S, Kato S, Fujii Y, Ishikawa K, Numata K, Kodama Y. ACS Synth Biol. 2022 Oct 21;11(10):3190-3197. doi: 10.1021/acssynbio.2c00367. Epub 2022 Sep 30. 10.1021/acssynbio.2c00367 PubMed 36178266