Punc-4c.TIR1
(Plasmid #194053)

• Purpose: TIR1 expression vector under the unc-4c promoter expressed in the DA motor neurons in C. elegans
• Depositing Lab: Kota Mizumoto
• Publication: Kurashina et al STAR Protoc. 2023 Jan 13;4(1):102028. doi: 10.1016/j.xpro.2022.102028.

Backbone

• Vector backbone: delta-pSM
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TIR1
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1887
• Mutation: codon-optimized for expression in C. elegans; Two point mutations D170E and M473L incorporated; Derived from pLZ31 (Addgene Plasmid #71720)
• Entrez Gene: TIR1 (a.k.a. AT3G62980, AtTIR1, TRANSPORT INHIBITOR RESPONSE 1)
• Promoter: unc-4c

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: unc-4c F GAAGTCTAGCAGGATTAAGC
• 3′ sequencing primer: unc-54 utr R cttagaagtcagaggcacgg

Resource Information

• Supplemental Documents:
  • Punc-4c.TIR1.ape
• A portion of this plasmid was derived from a plasmid made by: The TIR1 sequence was PCR-amplified from pLZ31 (pCFJ151_Peft-3_TIR1_linker_mRuby_unc-54 3'UTR) (Plasmid #71720).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry