pZCS16 (Peft-3::wrmScarlet::tbb-2 3'UTR in pUC19)
(Plasmid #154824)

• Purpose: (eft-3p::wrmScarlet::tbb-2 3'UTR in pUC19) Experimentally used to mark formation of transgenic arrays for C. elegans
• Depositing Lab: Patrick Phillips
• Publication: Stevenson et al G3 (Bethesda). 2020 Aug 19. pii: g3.120.401400. doi: 10.1534/g3.120.401400.

Backbone

• Vector backbone: pUC19
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 4339
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Peft-3::wrmScarlet::tbb-2 UTR
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 1653
• Promoter: eef-1A.1 (eft-3)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCCCTCGATCTCGAACTC
• 3′ sequencing primer: gcatctgagtgaagtgaatgc

Resource Information

• Supplemental Documents:
  • pZCS16.gb
• A portion of this plasmid was derived from a plasmid made by: wrmScarlet coding sequence was amplified from pSEM89, a gift from Thomas Boulin (Mouridi S., C. Lecroisey, P. Tardy, M. Mercier, A. Leclercq-Blondel, et al., 2017 Reliable CRISPR/Cas9 Genome Engineering in Caenorhabditis elegans Using a Single Efficient sgRNA and an Easily Recognizable Phenotype. G3: Genes, Genomes, Genetics 7: 1429– 1437. https://doi.org/10.1534/g3.117.040824) Peft-3 and tbb-2 UTR was amplified from pDD162 which was received from Addgene.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Protocols, sequence information, and updates can be found at: https://github.com/phillips-lab/SLP