Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Rapid Self-Selecting and Clone-Free Integration of Transgenes into Engineered CRISPR Safe Harbor Locations in Caenorhabditis elegans.
Stevenson ZC, Moerdyk-Schauwecker MJ, Jamison B, Phillips PC
G3 (Bethesda). 2020 Aug 19. pii: g3.120.401400. doi: 10.1534/g3.120.401400. PubMed Article

Plasmids from Article

ID Plasmid Purpose
154824pZCS16 (Peft-3::wrmScarlet::tbb-2 3'UTR in pUC19)(eft-3p::wrmScarlet::tbb-2 3'UTR in pUC19) Experimentally used to mark formation of transgenic arrays for C. elegans
154837pMS4 (Empty insertion vector with SEC)Vector that can be modified to add gene(s) of interest to C. elegans ChrII:8420157 site via CRISPR with SEC selection
154838pMS74 (synthetic guide::∆HYGR::unc-54 3' UTR^SEC)Insertion of split hygromycin landing pad into ChrII:8420157 site C. elegans strains via CRISPR with SEC selection
154839pMS79 (eft-3p::Cas9 + sgRNA)Cas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGG
154840pMS81(rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆)Insertion of rpl-28p::mKate2::unc-54 3'UTR into a split hygromycin landing pad. Can be modified to insert a different gene(s) of interest.

Antibodies from Article