Skip to main content

ChrV_oxTi365_loxP_myo2_neoR
(Plasmid #194057)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194057 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    loxP_myo2_neoR
  • Backbone manufacturer
    John Calarco's lab at University of Toronto
  • Modifications to backbone
    742bp and 946 bp 5' and 3' homology arm sequences pf oxTi365 locus are cloned at SacII and NotI sites
  • Vector type
    Worm Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    oxTi365
  • Species
    C. elegans (nematode)
  • Promoter None

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 (-41) Forward
  • 3′ sequencing primer pMyo2 ccctcaatgtctctacttgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ChrV_oxTi365_loxP_myo2_neoR was a gift from Kota Mizumoto (Addgene plasmid # 194057 ; http://n2t.net/addgene:194057 ; RRID:Addgene_194057)
  • For your References section:

    Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. Kurashina M, Mizumoto K. STAR Protoc. 2023 Jan 13;4(1):102028. doi: 10.1016/j.xpro.2022.102028. 10.1016/j.xpro.2022.102028 PubMed 36640369