pBB75-ncRNA
(Plasmid
#194087)
-
PurposeExpresses Ec86 ncRNA in Escherichia coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194087 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBB75
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEc86 ncRNA
-
gRNA/shRNA sequenceTGATAAGATTCCGTATGCGCACCCTTAGCGAGAGGTTTATCATTAAGGTCAACCTCTGGATGTTGTTTCGGCATCCTGCATTGAATCTGAGTTACTGTCTGTTTTCCTTGTTGGAACGGAGAGCATCGCCTGATGCTCTCCGAGCCAACCAGGAAACCCGTTTTTTCTGACGTAAGGGTGCGCAACTTTC
-
SpeciesE. coli
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer T7ter (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBB75-ncRNA was a gift from Tingting Zou (Addgene plasmid # 194087 ; http://n2t.net/addgene:194087 ; RRID:Addgene_194087) -
For your References section:
Cryo-EM structures of Escherichia coli Ec86 retron complexes reveal architecture and defence mechanism. Wang Y, Guan Z, Wang C, Nie Y, Chen Y, Qian Z, Cui Y, Xu H, Wang Q, Zhao F, Zhang D, Tao P, Sun M, Yin P, Jin S, Wu S, Zou T. Nat Microbiol. 2022 Sep;7(9):1480-1489. doi: 10.1038/s41564-022-01197-7. Epub 2022 Aug 18. 10.1038/s41564-022-01197-7 PubMed 35982312