Pramr-GFP
(Plasmid
#194148)
-
PurposeContains a RamR-regulated promoter expressing GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
- Total vector size (bp) 4473
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)743
-
GenBank IDABF13213.1 ABF13213.1
- Promoter Pramr
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acagggctataaggtagatccgggt
- 3′ sequencing primer gtgcccattaacatcaccatctaattc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pramr-GFP was a gift from Andrew Ellington (Addgene plasmid # 194148 ; http://n2t.net/addgene:194148 ; RRID:Addgene_194148) -
For your References section:
Using fungible biosensors to evolve improved alkaloid biosyntheses. d'Oelsnitz S, Kim W, Burkholder NT, Javanmardi K, Thyer R, Zhang Y, Alper HS, Ellington AD. Nat Chem Biol. 2022 Jul 7. pii: 10.1038/s41589-022-01072-w. doi: 10.1038/s41589-022-01072-w. 10.1038/s41589-022-01072-w PubMed 35799063