Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
(Plasmid #194247)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 194247 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miRaSynuclein(human)
  • gRNA/shRNA sequence
    GACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGTTCGTAGTCTTGATACCCTTCGTTTTGGCCACTGACTGACGAAGGGTAAAGACTACGAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGTTCAGGTTCGTAGTCTTGATAGTTTTGGCCACTGACTGACTATCAAGAACGAACCTGAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    420
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: The plasmid contains an 11bp deletion in one of the ITRs. This deletion does not affect plasmid performance as the virus undergoes self-repair of this region during AAV packaging.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 194247 ; http://n2t.net/addgene:194247 ; RRID:Addgene_194247)