pcDNA3.1(-) Full length Her2(ERBB2)-Fc
(Plasmid
#194330)
-
PurposeMammalian expression of full length Human epidermal growth factor (Her)-2-Fc fusion protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1 (-)
- Backbone size w/o insert (bp) 5409
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHer2-Fc
-
Alt nameERBB2-Fc
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2643
-
Entrez GeneERBB2 (a.k.a. CD340, HER-2, HER-2/neu, HER2, MLN 19, MLN-19, NEU, NGL, TKR1, VSCN2, c-ERB-2, c-ERB2, p185(erbB2))
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(-) Full length Her2(ERBB2)-Fc was a gift from Alexander McLellan (Addgene plasmid # 194330 ; http://n2t.net/addgene:194330 ; RRID:Addgene_194330)