pLEXSY-hyg2.1_LtIFT43_Flag
(Plasmid
#194433)
-
PurposeExpression of a flag tagged version of L. tarentolae intraflagellar transport protein-43 (IFT43) in Leishmania tarentolae
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLEXSY-hyg2.1
-
Backbone manufacturerJenaBioscience
- Backbone size w/o insert (bp) 8719
- Total vector size (bp) 9829
-
Modifications to backboneAdded a single XbaI site, linker sequence and 3X flag tag to the 3' of MCS
-
Vector typeLeishmania tarentolae expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntraflagellar transport complex subunit 43
-
Alt nameIFT43
-
SpeciesL. tarentolae
-
Insert Size (bp)1110
- Promoter L.donovani promoter elements
-
Tags
/ Fusion Proteins
- 3X Flag (C terminal on backbone)
- Linker (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BgIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CCTTGCCACCAGATCTGCCATGTCCACGACTTCTATGACTGCC
- 3′ sequencing primer CCGGAGCCTCTAGACTTCGAAACCTGCTTGGATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEXSY-hyg2.1_LtIFT43_Flag was a gift from Alan Brown (Addgene plasmid # 194433 ; http://n2t.net/addgene:194433 ; RRID:Addgene_194433) -
For your References section:
Mechanism of IFT-A polymerization into trains for ciliary transport. Meleppattu S, Zhou H, Dai J, Gui M, Brown A. Cell. 2022 Dec 22;185(26):4986-4998.e12. doi: 10.1016/j.cell.2022.11.033. 10.1016/j.cell.2022.11.033 PubMed 36563665